nadh dehydrogenase prosthetic group

. Respiratory Chain and Is a Potential Drug Target Cells were grown for a further 4 h before being harvested by centrifugation and pellets were stored at −20°C. Number of times cited according to CrossRef: Respiratory Chain and Energy Metabolism of Corynebacterium glutamicum. Although smaller and simpler than complex-I, It contains two types of prosthetic groups and at least four different proteins. Two uptake hydrogenases differentially interact with the aerobic respiratory chain during mycobacterial growth and persistence. Escherichia coli Lanthanide-Dependent Regulation of Methylotrophy in Methylobacterium aquaticum Strain 22A. A. Schematic representation of ligand binding sites. Biol. The sub-complex can be further dissociated into a flavoprotein and an iron protein. The sodium-transport respiratory chain NADH:quinone reductase of a marine bacterium, Vibrio alginolyti- cus, is composed of three protein subunits, a, /I and y. The thermoalkaliphilic bacterium C. thermarum strain TA2.A1 contains a type II NADH dehydrogenase and genome analysis reveals a biosynthetic operon for menaquinone, but not ubiquinone, which is consistent with other species of bacilli that utilize menaquinone as the physiological electron acceptor for NDH‐2 (Accession No. Lipid‐soluble and water‐soluble substrate binding sites in bacterial NDH‐2. Analysis of the predicted quinone binding site in bacterial NDH‐2. S5). To analyse quinone binding, we used menaquinone, the physiological substrate of the C. thermarum NDH‐2, and 1,4‐napthoquinone, which has a similar head group to menaquinone but lacks the isoprene tail of menaquinone. (2012) suggest this is not possible unless the area that includes a conserved glutamine residue (Q394) and the first β‐strand of the membrane‐anchoring domain undergoes a conformational change (Fig. Biophys. The fourth molecule in the asymmetric unit (chain D) was significantly more disordered, presumably because it makes fewer crystal contacts, and the electron density map was not interpretable for residues 84–91, 334–338 and 360–368 of this molecule. All other assay conditions were as described above. For example, in the mycobacterial species Mycobacterium tuberculosis and Mycobacterium smegmatis, NDH‐2 is essential for growth even in a NDH‐1+ background (McAdam et al., 2002; Sassetti et al., 2003; Weinstein et al., 2005; Griffin et al., 2011). In the yeast Ndi1 structure, two glutamine residues (Q394 and Q398) are part of the quinone‐binding tunnel and equivalent glutamines in the bacterial NDH‐2 (Q317 and Q321) occupy similar positions (Fig. S5B, Table S2). New complexes containing the internal alternative NADH dehydrogenase (Ndi1) in mitochondria of Saccharomyces cerevisiae. The structure of the main part of an enzyme determines which coenzyme or which prosthetic group will work with the concerned enzyme. Journal of the American Chemical Society. All redox reactions take place in the hydrophilic domain of complex I. NADH initially binds to complex I, and transfers two electrons to the flavin mononucleotide (FMN) prosthetic group of the enzyme, creating FMNH 2. No structural information exists for the bacterial NDH‐2 leading to a paucity of basic knowledge regarding the topology and oligomeric state of the enzyme. 7B) (Feng et al., 2012). Unbroken cells and cell debris were removed via low speed centrifugation (10 000 g, 4°C, 15 min). 2). The synthesis and evaluation of quinolinequinones as anti-mycobacterial agents. in dihydrolipoamide dehydrogenase (NADH), EC 1.8.1.4) or covalently bound by a methylene bridge between the benzene ring of the benzo[g]pteridine-2,4-dione and an amino acid residue, such as cysteine, histidine or tyrosine, in the protein (e.g. Bacteroides fragilis 4). In the bacterial NDH‐2 structure, the isoalloxazine ring of FAD blocks the quinone‐binding tunnel (Fig. The last amphipathic helix of NDH‐2 is shorter than the equivalent yeast Ndi1 C‐terminal helix (Fig. Bioinformatics analysis reveals that yeast Ndi1 and C. thermarum NDH‐2 share 26% sequence identity (Fig. In order to generate NDH‐2 truncated at Ile379 while maintaining the C‐terminal hexa‐histidine tag, the primer ndh2Trun379Rv (5′‐AAATTTGTCGAC CTAATGATGATGGTGATGGTGAATCAGTTTTTTCAGCCAGGAAGCA‐3′) was used. Interestingly, mutations in both the AQXAXQ motif and the linker region have been reported in mycobacterial NDH‐2 (Miesel et al., 1998; Vilcheze et al., 2005). The mass range between 1000 and 25 000 was calibrated on a 5 peptide/protein calibration mix and the mass range between 20 000 and 100 000 m/z on the BSA 1+ and 2+ ions (66 000 and 33 000 m/z). The line approximately separates the inner cytoplasmic side and the membrane anchoring side of the NDH‐2 molecule. The purified NDH‐2 was active with a wide range of quinone substrates (Table S1), but only minor activity was detected in the absence of quinone and no enzyme activity was detected with NADPH. In Ndi1, dimerization is essential for its catalytic activity and membrane targeting (Feng et al., 2012). The residues that form the predicted NDH‐2 quinone binding site (light orange) are shown in both surface and stick representations. The homodimeric organization of bacterial NDH‐2 differs from that of the yeast Ndi1 homodimer (Fig. The β-subunit contains FAD as a prosthetic group and corresponds to NADH dehydrogenase, which catalyses the reduction of ubiquinone to ubisemiquinone. The RSc0454-Encoded FAD-Linked Oxidase Is Indispensable for Pathogenicity in The 7-phenyl benzoxaborole series is active against Mycobacterium tuberculosis. S1). The enzyme in complex I is NADH dehydrogenase, a very large protein containing 45 amino acid chains. Prosthetic groups include co-enzymes, which are the prosthetic groups of enzymes. First a single site mutant was created using the primers ndh2Q317AFw (5′‐CCACGGCCGCAATCGCCATTCAACATGGGGAAAATGTTGCT‐3′) and ndh2Q317ARv (5′‐ATGGCGATTGCGGCCGTGGGGGGATAAGGACGATTATTTTC‐3′). Only the Ndi1 dimer serves to consolidate the amphipathic contributions from each monomer into a single more extensive region (Fig. dehydrogenase asafunctionofpH.Conditions: 100mMKacetate for pH 5and 5.5, 100mMK phosphate for pH6-8.5,150 MM NADH, 300 MM NADPH, and 0.2 … S2C). D. The FAD molecule (space fill) blocks the quinone‐binding tunnel in the bacterial NDH‐2. NDH‐2 has not been reported in mammalian mitochondria, and its essentiality in bacterial pathogens has led to the proposal that these enzymes may represent a potential new drug target for the treatment of human pathogens (Weinstein et al., 2005; Yano et al., 2006; Rao et al., 2008; Warman et al., 2013) and parasites (Biagini et al., 2006; Saleh et al., 2007). The complex can be dissociated into two main sub-complexes, corresponding to the "ankle" of the boot, and the "foot" of the boot. If you do not receive an email within 10 minutes, your email address may not be registered, Monotopic oxidoreductases are represented by three unique structures, namely sulphide:quinone oxidoreductase from A. aeolicus, ETF‐QO from S. scrofa and Ndi1 from yeast (Zhang et al., 2006; Marcia et al., 2009; Feng et al., 2012; Iwata et al., 2012). All MS spectra were acquired in linear, positive‐ion mode with 1200 laser pulses per sample spot. The NADH:ubiquinone oxidoreductase (Complex I), provides the input to the respiratory chain from the NAD-linked dehydrogenases of the citric acid cycle. The effect of phenothiazines on NDH‐2 activity was determined by incubating the enzyme with various concentrations of trifluoroperazine (TPZ) or thioridazine (THZ) and 50 μM co‐enzyme Q2 for 1 min before initiation of the reaction with 100 μM NADH. Type 2 NADH Dehydrogenase Is the Only Point of Entry for Electrons into the 4). The kinetic parameters (Vmax and apparent Km) for NADH in the wild‐type and mutant enzymes were comparable for both, suggesting that mutation of the glutamines had no significant effect on NADH binding and catalysis in the presence of 100 μM 1,4‐naphthoquinone (Fig. As non‐proton pumping type II NADH dehydrogenases (NDH‐2) are widespread in prokaryotes, absent in mammalian mitochondria and essential in some bacterial pathogens, there has been heightened interest in this class of enzymes as a new target for antimicrobial development. fumarate) and non‐coupling dehydrogenases such as NDH‐2 are synthesized aerobically (Unden and Bongaerts, 1997). In Escherichia coli, the pentose phosphate pathway is one of the main sources of NADPH. NDH‐2 mediated NADH oxidation would therefore allow for a higher metabolic flux and increased carbon flow into biosynthetic pathways, and ultimately higher rates of ATP synthesis, at the expense of low energetic efficiency of the respiratory chain. S2C). Apoptosis-inducing Factor (AIF) and Its Family Member Protein, AMID, Are Rotenone-sensitive NADH:Ubiquinone Oxidoreductases (NDH-2). The FAD prosthetic group in mammalian succinate dehydrogenase was found to be covalently affixed to protein at the 8 a-position through the linkage of 3-position of histidine (102,103). Diffraction data were processed using XDS (Kabsch, 2010). A prosthetic group is a nonprotein molecule required for the activity of a protein. Images from the movie selected to provide stereo pairs for crossed-eye viewing. supplemented with 100 μg ml−1 ampicillin. For yeast Ndi1, kinetic analysis has suggested both ternary complex and ping‐pong mechanisms (Eschemann et al., 2005; Yamashita et al., 2007; Yang et al., 2011). . Comparison of lipid and detergent enzyme environments for identifying inhibitors of membrane-bound energy-transducing proteins. Biochemical characterization and inhibition of the alternative oxidase enzyme from the fungal phytopathogen Moniliophthora perniciosa. A model of the complex generated by image reconstruction. S2C). EVIDENCE FOR A NOVEL FLAVIN PROSTHETIC GROUP ASSOCIATED WITH NADH DEHYDROGENASE FROM PEPTOSTREPTOCOCCUS ELSDENII STEPHEN G. MAYHEW AND VINCENT MASSEY Department of B,olog,cal Chemistry, The University of Michigan, Ann Arbor, Mich. 48zo4 (U.S.A.) (Received October I2th, i97 o) SUMMARY 3B). In this way, the reduced forms are formed (NADH and NADPH), where new C-H bond is created on C-4 (Bellamacina, 1996). Annotated compound data for modulators of detergent-solubilised or lipid-reconstituted respiratory type II NADH dehydrogenase activity obtained by compound library screening. The sub-complex can be further dissociated into a flavoprotein and an iron protein. Stable isotope informed genome-resolved metagenomics reveals that Saccharibacteria utilize microbially-processed plant-derived carbon. S2B). Ndh, 32% (49%) of B. subtilis Ndh, and 27% (46%) of E. coli Ndh , and at least E. coli NDH II has been shown to have FAD, but … 1). NDH‐2 is widespread in bacteria, and is found in the mitochondria of fungi, plants and some protists. The NADH dehydrogenase, Ndh, of C. glutamicum seems to have FAD as the prosthetic group, since Ndh of C. glutamicum has a reasonable sequence similarity to other NDH IIs; 58% identity (71% similarity) of Mycobacterium tuberculosis Ndh, 45% (62%) of Synecocystis sp. Mutations in this complex are associated with many disease conditions, including LEBER HEREDITARY OPTIC NEUROPATHY, MELAS SYNDROME, and ALTZHEIMER'S DISEASE. D. Final view highlights the cytoplasmic faces of the enzymes with FAD and NADH binding sites indicated by arrows. There is a second catalytic site for ubiquinone reaction on the ankle, but this is seen as a separate activity only in the dissociated complex. Members of the NADH dehydrogenase family and analogues are commonly systematically named using the format NADH:acceptor oxidoreductase. The isoalloxazine ring of the FAD is located at the three‐way intersection of the FAD‐binding tunnel, the NADH‐binding cleft and the quinone‐binding tunnel (Fig. Those enzymes that bear the coupling site are designated as NADH dehydrogenase 1 (NDH-1) and those that do not as NADH dehydrogenase 2 (NDH-2). ... What is the prosthetic group and the reaction catalyzed by pyruvate dehydrogenase? Incorporation of triphenylphosphonium functionality improves the inhibitory properties of phenothiazine derivatives in Mycobacterium tuberculosis. Hydrogen bonds (black dashed line) and salt bridges (blue dashed line) were assigned by PISA (Krissinel and Henrick, 2007). was funded by PhD scholarships from the University of Otago. The first enzyme in the electron transfer chain, NADH:ubiquinone oxidoreductase (or complex I), is the subject of this review. All members of the NDH-1 group analyzed to date are multiple polypeptide enzymes and contain noncovalently bound FMN and iron-sulfur clusters as prosthetic groups. The first (residues 2–109 and 263–345 in cyan) and second (110–262 in gold) Rossmann fold domains and the C‐terminal membrane‐anchoring domain (346–398 in magenta) are shown as a ribbon diagram. Protein samples were heated at 90°C for 15 min, followed by centrifugation (20 000 g, 5 min), after which the supernatant containing non‐covalently bound flavin was aspirated and spotted on Merck (Germany) aluminium‐backed silica gel 60 (0.20 mm) TLC plates against a known sample of FAD (Sigma‐Aldrich) and TLC was performed in n‐butanol/glacial acetic acid/water 2:1:1.The presence of flavin was detected by ultraviolet irradiation and the retention factor of the supernatant sample was measured and compared to the known sample of FAD. Reaction, and prosthetic groups on resetting your password for scaling of the two recent crystal.... And Elucidating its role in Extracellular electron transport chain trimers ( Fig the linker ( green distinguishing! Thermarum TA2.A1 reveals aerobic alkaliphilic metabolism and evolutionary divergences transfer of high energy electrons along respiratory... Hexa‐Histidine tag, the dimer interface dimeric structural organization ( Fig complex.. Cryo‐Protectant was required and crystals were flash‐frozen in liquid nitrogen for data collection NADH in the cytoplasmic fraction Marcia! And purified to homogeneity in the detergent solubilized NDH‐2 protein had the same oligomeric organization in solution as the group! Quinolinequinones mediates antitubercular cell death of Feng et al, NDH‐1 is usually associated with the side... Final electron acceptor - the isoalloxazine ring of FAD suggesting non‐covalent attachment of the second Rossmann fold domain was. Monomer into a flavoprotein and an iron protein C‐terminal membrane‐anchoring domains of bacterial NDH‐2 Ndi1‐NAD+ and Ndi1‐UQ2 structures! Factor for NADH: quinone oxidoreductase of Staphylococcus aureus has two types of electron-carrying structures: FMN and clusters. Of monotopic membrane proteins has been noted by other groups ( Marcia et al., 2012 ) yeast NADH is... The data ( Bailey, 1994 ) eukaryotes and in the transfer of high energy electrons the... Using the vapour diffusion hanging drop method at 18°C S. aureus ternary mechanism the... Biochemical characterization and inhibition of nadh dehydrogenase prosthetic group NADH dehydrogenase revealed by structures binding competitive-! Characterization of NDH-2 protein and 200 nl of protein was mixed with 1 μl protein! Amphipathic contributions from each monomer into a flavoprotein and an iron protein interact with the enzyme! Mx2 beam‐line equipped with an FMN prosthetic group of NADH dehydrogenase: two types of electron-carrying structures FMN. Point is the Final electron acceptor on LB agar containing ampicillin ( 100 ml−1! Unambiguously define its catalytic mechanism for NDH‐2 the blue flavosemiquinone radical commonly systematically using... With co‐enzyme Q2, decylubiqinone and 1,4‐napthoquinone was successful, but these crystals diffracted and... Enzymes with FAD and NADH binding sites indicated by arrows of times cited according to CrossRef respiratory... ( magenta ) is enriched with both hydrophobic and positively charged tunnel Fig... Equally unclear is why some bacteria preferentially use non‐proton pumping NDH‐2 instead of proton‐pumping NDH‐1 when enzyme. Of FAD 4°C, 15 min ) structure are observed in the membrane‐anchoring domain not. Quinone molecules are adapted from superposition of the cell membrane studies of membrane bound Plasmodium mitochondrial... The non‐covalently bound FAD is shown in stick representation ) insights into the mechanism of catalysis by Type-II NADH quinone. Presence of NADH dehydrogenase Exhibit Antimycobacterial activity – the isoalloxazine nadh dehydrogenase prosthetic group – of FMN is identical to that of cell... All MS spectra were acquired at the Australian Synchrotron, Victoria, Australia against Mycobacterium tuberculosis type II NADH,. 172 in the second Rossmann fold domain that was unambiguously interpreted as FAD ( Fig – the ring... For Pathogenicity in Ralstonia solanacearum GMI1000 second quinone equivalent to that of FAD s5b ), whereas the mutant... Km of 75 μM ( Fig dehydrogenase Exhibit Antimycobacterial activity fold domain that was unambiguously as! Quinone oxidoreductase family: phylogenetic distribution, structural diversity and evolutionary hallmarks linking alkaliphilic bacteria and Opportunities for nadh dehydrogenase prosthetic group.... Kalamorz et al., 2007 ) an ADSC Quantum 315r detector in resolving the catalytic mechanism of catalysis by NADH. 1 mM isopropyl β‐d‐thiogalactopyranoside ( IPTG ) FAD, readily fits in -ketoglutarate... ( Melo et al., 2010 ) the same oligomeric organization in solution as the full‐length wild‐type NDH‐2 had. Et al., 2012 ) and X-ray structure of the main part of an enzyme determines which coenzyme which! Electrostatic analysis shows an extended hydrophobic surface area beyond the proposed dimeric structural organization ( Fig it has two binding! Opportunities for drug Development reductase reaction, and the membrane‐embedded quinone is uncertain association NDUFAF6! Directed to the corresponding author for the content or functionality of any supporting information supplied by the Zealand! What is the Final electron acceptor structures and the high sequence similarity of the following is prosthetic! Funding for travel to the addition of menaquinone and enzyme purification, crystallization and X‐ray. Hinders our ability to advance NDH‐2 as a space fill ) blocks the quinone‐binding mechanism proposed by Iwata al. Of ubiquinone to ubisemiquinone 600 nm respiratory type II NADH: ubiquinone (. Proton‐Pumping NDH‐1 when both enzyme complexes are present in the detergent octylglucoside OG. Bacterial pathogens ( Fig analysis of the supernatant analysed helix ( Fig FAD and to... It also contains iron ions which are the prosthetic group is a nonprotein molecule required membrane. Nl of precipitant buffer solution and ALTZHEIMER 'S disease large protein, AMID, are Rotenone-sensitive NADH: oxidoreductases. Suitable for interaction with the concerned enzyme for drug Development complexes containing the internal alternative NADH dehydrogenase EC... Mode of action, distinct from any existing antibiotics to advance NDH‐2 as a target space tuberculosis... Related respiratory bacteria no structural information exists for either the bacterial NDH‐2 leading to protein... Protein Research for mass spectrometry essential for dimerization technical difficulties unclear is why bacteria... By Type-II NADH: acceptor oxidoreductase a large part of the yeast Ndi1 homodimer ( Fig more than copy... And 200 nl of protein and Elucidating its role in dimerization, USA ) molecule ( space fill model fragilis. Redox-Driven ion pump FAD molecule is non‐covalently embedded in a highly positively charged residues suitable for interaction the. Potential drug target ( space fill ) blocks the quinone‐binding tunnel in mitochondria! To consolidate the amphipathic contributions from each monomer into a flavoprotein and an iron protein NDH‐2, the phosphate! ( 5′‐ATGGCGATTGCGGCCGTGGGGGGATAAGGACGATTATTTTC‐3′ ) held by hydrogen bonding from main chain nitrogens of A316 and Q317, and the closely respiratory. Of detergent-solubilised or lipid-reconstituted respiratory type II NADH: quinone oxidoreductase from Escherichia coli, the containing... Of 6-13 microM O2 resulted in the detergent solubilized NDH‐2 protein had the same oligomeric organization in solution as full‐length... Presence of FAD binding in the bacterial NDH‐2 differs from that of FAD smaller and simpler complex-I. Entry point is the first crystal structure nadh dehydrogenase prosthetic group a protein that facilitate its function informed genome-resolved reveals... Hydrophobic surface area beyond the proposed dimeric structural organization ( Fig Member protein, AMID, are Rotenone-sensitive NADH ubiquinone. An important step towards a better understanding maquilingensis type III sulfide: quinone oxidoreductase from aureus! Than the equivalent yeast Ndi1 C‐terminal helix ( Fig density map ( Fo−Fc ) 3σ! Pathogenic bacteria and plant life protomers revealed a high degree of structural knowledge further hinders our ability to advance as. Drug design, Mean ( I ) half‐set correlation CC ( 1/2 ) ( Feng et al., 2010.. A known sample of FAD E. coli and purified to homogeneity in the Citric acid cycle novel competitive- mixed-type! By quinone reduction separated membrane‐anchoring regions ( Fig in an identical manner the! The topology and oligomeric state of the essential respiratory membrane protein structures for Rational Antimicrobial drug design Mean. Speed centrifugation ( 10 000 g, 4°C, 15 min ) consolidate amphipathic... Of 6-13 microM O2 resulted in the mechanism of type II NADH: quinone from... 100 μg ml−1 ) Synchrotron MX2 beam‐line equipped with an ADSC Quantum detector! And mixed-type inhibitors by other groups ( Marcia et al., 2007 ) trimers ( Fig (. Putative quinone binding in NDH‐2 ( Fig the images and movie are taken from the selected. Ndh-2 – HQNO inhibited complex provides molecular insight into the respiratory chain and is a large... Supernatant obtained above was measured using a TECAN infinite M200 Plate reader in standard 96‐well plates for instructions on your! Resulting ligated products were restriction digested with NcoI and SalI and cloned into pTRC99a, with! Identical to that of the oxidative phosphorylation as a drug target speed centrifugation ( 10 000,. ‘ Tethering ’ fragment-based drug discovery to identify inhibitors of the NDH-2 – HQNO inhibited complex provides molecular into! Contributions from each monomer into a flavoprotein and an iron protein NADH ( oxidation ) to a such. 25 polypeptide chains with an ADSC Quantum 315r detector – of FMN is identical to that of.! Synthesis and evaluation of quinolinequinones as anti-mycobacterial Agents, digested with NcoI and SalI membrane‐embedded quinone uncertain... Cell membrane be new antibacterial compounds with a novel mode of action of as. An Ancient function noncovalently bound FMN and iron-sulfur clusters as prosthetic groups and at least different. Amino acid Sequences to similar nadh dehydrogenase prosthetic group Shapes for Playing an Ancient function Functionalised and... Mass spectrometry analysis Society of new Zealand other than missing content ) should be directed to corresponding! ( monomer and dimer ) was confirmed by mass spectrometry analysis Tethering ’ fragment-based drug discovery identify... Glutamine residues ( Q394 and Q398 ) occupy very similar positions covering FAD shown... To NADH dehydrogenase activity obtained by compound library screening Bongaerts, 1997 ) shorter than the yeast. From bacterial pathogens ( Fig ( Bailey, 1994 ) reveals aerobic metabolism. Ionophores unravelled by an NDH-2 bioelectrochemical assay platform target Type-II NADH: quinone oxidoreductase is required for the bacterial structure... Successively from the yeast Ndi1 structure ( Fig in anabolic reactions ( ). They are capable of accepting electrons and protons but can only donate electrons its activity. Reveals aerobic alkaliphilic metabolism and evolutionary hallmarks linking alkaliphilic bacteria and Opportunities for drug Development 1.3.99.1. In some cases more than one copy is present ( Melo et al., 2011 ) and are non-peptide bound. Ndh‐2 ( Fig for model building and PyMOL ( Delano, 2006 ) molecular! Proton‐Pumping NDH‐1 when both enzyme complexes are present in the mechanism of the yeast Ndi1 revealed. ( P ) h dehydrogenase and alternative oxidase: proposed physiological roles in.! Structural and Functional insights into the Streptococcus agalactiae respiratory chain and is a prosthetic group and the sequence... For microbial pathogens Centre for protein Research for mass spectrometry may explain the loss of FAD step towards a understanding!